forward primer Search Results


86
Sangon Biotech gatccttgatcgtttcggctg sangon biotech n a actin forward
Gatccttgatcgtttcggctg Sangon Biotech N A Actin Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pm40449480-254-199-200?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
gatccttgatcgtttcggctg sangon biotech n a actin forward - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/10__1161_slash_circgenetics__113__000023-357-51-93?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
ACGT Inc forward primer 5'-agct ctcgag gtcatgtccagtgacatggtagacgggattaaac-3
Forward Primer 5' Agct Ctcgag Gtcatgtccagtgacatggtagacgggattaaac 3, supplied by ACGT Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pmc01091696-131-16-17?v=ACGT+Inc
Average 90 stars, based on 1 article reviews
forward primer 5'-agct ctcgag gtcatgtccagtgacatggtagacgggattaaac-3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GeNOsys Inc forward primer 5 -tgttttgg gacgatgttcca-3
Forward Primer 5 Tgttttgg Gacgatgttcca 3, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pm11241166-41-12-1?v=GeNOsys+Inc
Average 90 stars, based on 1 article reviews
forward primer 5 -tgttttgg gacgatgttcca-3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Biolegio bv forward primer tcaaagatgaacctaactgcactca
Forward Primer Tcaaagatgaacctaactgcactca, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pm15224405-84-33-40?v=Biolegio+bv
Average 90 stars, based on 1 article reviews
forward primer tcaaagatgaacctaactgcactca - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag tetlabelled arch21f forward primer
Tetlabelled Arch21f Forward Primer, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pm15727822-71-9-12?v=MWG-Biotech+ag
Average 90 stars, based on 1 article reviews
tetlabelled arch21f forward primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Microsynth ag fshr forward primer
Fshr Forward Primer, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pm19224509-66-10-4?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
fshr forward primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Biolegio bv barcoded forward primer and reverse primer mix biolegio bv
Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pmc04717173-144-36-39?v=Biolegio+bv
Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag forward primers end-labeled cy5.5 fluorescent dye
Forward Primers End Labeled Cy5.5 Fluorescent Dye, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/10__1194_slash_jlr__m200248___jlr200-120-13-16?v=MWG-Biotech+ag
Average 90 stars, based on 1 article reviews
forward primers end-labeled cy5.5 fluorescent dye - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Retrogen Inc sequencing primers (forward 5′ aggccgggtgtgtaagcgca 3′; reverse cggaacggacgggactcga 3′)
Sequencing Primers (Forward 5′ Aggccgggtgtgtaagcgca 3′; Reverse Cggaacggacgggactcga 3′), supplied by Retrogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/pmc06989188-126-0-18?v=Retrogen+Inc
Average 90 stars, based on 1 article reviews
sequencing primers (forward 5′ aggccgggtgtgtaagcgca 3′; reverse cggaacggacgggactcga 3′) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc universal forward primer c1-j-1718
Universal Forward Primer C1 J 1718, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/10__1007_slash_s10526___022___10141___x-42-31-0?v=PrimerDesign+Inc
Average 90 stars, based on 1 article reviews
universal forward primer c1-j-1718 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc forward primer csn1s2-5’f
Forward Primer Csn1s2 5’f, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+primer/10__4081_slash_ijas__2010__e40-28-38-0?v=PrimerDesign+Inc
Average 90 stars, based on 1 article reviews
forward primer csn1s2-5’f - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results