86
|
Sangon Biotech
gatccttgatcgtttcggctg sangon biotech n a actin forward Gatccttgatcgtttcggctg Sangon Biotech N A Actin Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pm40449480-254-199-200?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
gatccttgatcgtttcggctg sangon biotech n a actin forward - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/10__1161_slash_circgenetics__113__000023-357-51-93?v=Thermo+Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
90
|
ACGT Inc
forward primer 5'-agct ctcgag gtcatgtccagtgacatggtagacgggattaaac-3 Forward Primer 5' Agct Ctcgag Gtcatgtccagtgacatggtagacgggattaaac 3, supplied by ACGT Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pmc01091696-131-16-17?v=ACGT+Inc Average 90 stars, based on 1 article reviews
forward primer 5'-agct ctcgag gtcatgtccagtgacatggtagacgggattaaac-3 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
GeNOsys Inc
forward primer 5 -tgttttgg gacgatgttcca-3 Forward Primer 5 Tgttttgg Gacgatgttcca 3, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pm11241166-41-12-1?v=GeNOsys+Inc Average 90 stars, based on 1 article reviews
forward primer 5 -tgttttgg gacgatgttcca-3 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
forward primer tcaaagatgaacctaactgcactca Forward Primer Tcaaagatgaacctaactgcactca, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pm15224405-84-33-40?v=Biolegio+bv Average 90 stars, based on 1 article reviews
forward primer tcaaagatgaacctaactgcactca - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
tetlabelled arch21f forward primer Tetlabelled Arch21f Forward Primer, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pm15727822-71-9-12?v=MWG-Biotech+ag Average 90 stars, based on 1 article reviews
tetlabelled arch21f forward primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
fshr forward primer Fshr Forward Primer, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pm19224509-66-10-4?v=Microsynth+ag Average 90 stars, based on 1 article reviews
fshr forward primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
barcoded forward primer and reverse primer mix biolegio bv Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pmc04717173-144-36-39?v=Biolegio+bv Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
forward primers end-labeled cy5.5 fluorescent dye Forward Primers End Labeled Cy5.5 Fluorescent Dye, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/10__1194_slash_jlr__m200248___jlr200-120-13-16?v=MWG-Biotech+ag Average 90 stars, based on 1 article reviews
forward primers end-labeled cy5.5 fluorescent dye - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Retrogen Inc
sequencing primers (forward 5′ aggccgggtgtgtaagcgca 3′; reverse cggaacggacgggactcga 3′) Sequencing Primers (Forward 5′ Aggccgggtgtgtaagcgca 3′; Reverse Cggaacggacgggactcga 3′), supplied by Retrogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/pmc06989188-126-0-18?v=Retrogen+Inc Average 90 stars, based on 1 article reviews
sequencing primers (forward 5′ aggccgggtgtgtaagcgca 3′; reverse cggaacggacgggactcga 3′) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
universal forward primer c1-j-1718 Universal Forward Primer C1 J 1718, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/10__1007_slash_s10526___022___10141___x-42-31-0?v=PrimerDesign+Inc Average 90 stars, based on 1 article reviews
universal forward primer c1-j-1718 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
forward primer csn1s2-5’f Forward Primer Csn1s2 5’f, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+primer/10__4081_slash_ijas__2010__e40-28-38-0?v=PrimerDesign+Inc Average 90 stars, based on 1 article reviews
forward primer csn1s2-5’f - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |